View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18142_low_12 (Length: 232)
Name: NF18142_low_12
Description: NF18142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18142_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 42670234 - 42670340
Alignment:
| Q |
18 |
aggtgatgtatggttcgacactctcgatgatgttctcacgtccttcgtatccctaatctggtggggctgcctctctttttaaaatgtataatattgaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42670234 |
aggtgatgtatggttcgacactctcgatgatgttctcacgtccttcgtatccctaatctggtggggctgcctctctttttaaaatgtataatattgaaat |
42670333 |
T |
 |
| Q |
118 |
gattgtt |
124 |
Q |
| |
|
||||||| |
|
|
| T |
42670334 |
gattgtt |
42670340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 42670372 - 42670440
Alignment:
| Q |
145 |
aatcgatgaatactaacaaccaaatgcatgtgtgtttggtttcatatttcagacacaaaatacttgtttg |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42670372 |
aatcgatggatactaacaaccaaatgcatgtgtgtttggtttcatatttcag-cacaaaatacttgtttg |
42670440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University