View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18143_high_12 (Length: 227)
Name: NF18143_high_12
Description: NF18143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18143_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 13315718 - 13315604
Alignment:
| Q |
7 |
catttggtcttaggtttgggcttaaatcgattcaatcttttgtttgatttcttttaagttctcatcaataagtaaagacagatcttcaagatcactttcg |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
13315718 |
catttggtcttaggtttgggcttgaatcgattcaatcttttgtttgatttctgttaagttctcatcaataagtaaagacagatcttcgagatcactctcg |
13315619 |
T |
|
| Q |
107 |
ctcaaatttccatca |
121 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
13315618 |
ctcaaattttcatca |
13315604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 227
Target Start/End: Complemental strand, 13309265 - 13309167
Alignment:
| Q |
126 |
tggtagttgttaataaatattactagtagtattcataactaatggttactgcagcagtgtcgacaacaacacaatgatagacttttttattcaatcaaac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13309265 |
tggtagttgttaataaatattactagta---ttcataactaatggttactgcaacagtgtcgacaacaacacaataatagacttttttattcaatcaaac |
13309169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University