View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18143_low_10 (Length: 262)
Name: NF18143_low_10
Description: NF18143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18143_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 60 - 244
Target Start/End: Complemental strand, 7342059 - 7341872
Alignment:
| Q |
60 |
tattaatcaaccatgaa-taatcaaatttgtgattggaactagaattttaaaaactttgcattggtgtaactttgtaagcattgcatttgcaccttgatt |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7342059 |
tattaatcaaccatgaaataatcaaatttgtgattggaactagaattttaaaaactttgcattggtgtaactttgtaagcattgcatttgcaccttgatt |
7341960 |
T |
 |
| Q |
159 |
--ctatatgaagtgagaaagaaagagagatgaggaagttaaagatgatacctgttgagccattactggacttgagggaatgatgatat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341959 |
atctatatgaagtgagaaagaaagagagatgaggaagttaaagatgatacctgttgagccattactggacttgagggaatgatgatat |
7341872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University