View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18144_high_7 (Length: 236)
Name: NF18144_high_7
Description: NF18144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18144_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 32527163 - 32526960
Alignment:
| Q |
20 |
gcaacttcatcccactgacctaaagcggcatacatgttggaaaggattatgtaggttccatcttgccctggaataagctcgaggagtcggtcagcagctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32527163 |
gcaacttcatcccactgacctaaagcggcatacatgttggaaaggattatgtaggttccatcttgccctggaataagctcgaggagtcggtcagcagctt |
32527064 |
T |
 |
| Q |
120 |
gaatacctaattccatgttcccgtgaatccgacaaccagcaagaagagcttcccaaattggcgcaccggcctcgaaaggcattgattttattacactctg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32527063 |
gaatacctaattccatgttcccgtgaatccgacaaccagcaagaagagcttcccaaattggcgcaccggcctcgaaaggcattgattttattacactctg |
32526964 |
T |
 |
| Q |
220 |
tgct |
223 |
Q |
| |
|
|||| |
|
|
| T |
32526963 |
tgct |
32526960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University