View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18144_low_12 (Length: 211)
Name: NF18144_low_12
Description: NF18144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18144_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 2328344 - 2328529
Alignment:
| Q |
13 |
cagagaacattttcaagtgggtatctaattggccaaaaattgttgatgcaatttctactatttgtagactaatggatgaaattgtgaccagtgaggtatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2328344 |
cagagaacattttcaagtgggtatctaattggccaaaaattgttgatgcaatttctactatttgtagactaatggatgaaattgtgaccagtgaggtatt |
2328443 |
T |
 |
| Q |
113 |
tatatatcacatctatatctagatatatagaaaatttaagctttatttctctctaatgtaagttttttacacaatagaaattgttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2328444 |
tatatatcacatctatatctagatatatagaaaatttaagctttatttctctctaatgtaagttttttacacaatagaaattgttg |
2328529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University