View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18148_low_1 (Length: 556)
Name: NF18148_low_1
Description: NF18148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18148_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 2e-47; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 8154027 - 8153927
Alignment:
| Q |
24 |
gttacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttattagattgccctgccgtttcgagaatcttggaat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8154027 |
gttacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttaatagattgccctgccgtttcgagaatcttggaat |
8153928 |
T |
|
| Q |
124 |
a |
124 |
Q |
| |
|
| |
|
|
| T |
8153927 |
a |
8153927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 404 - 519
Target Start/End: Complemental strand, 8152906 - 8152790
Alignment:
| Q |
404 |
aattggacgcctcagatttttcacttattaaggcattcactttttgttgggtattgctataccaaaaaacccgacctcacct-aagattaaataacaatt |
502 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
8152906 |
aattggacggctcagatttttgacttattaaggcattcactttttgttgggtattgctataccaaaaaacccgacctcacctcaggattagataacaatt |
8152807 |
T |
|
| Q |
503 |
tctgatttgtttgaaat |
519 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8152806 |
tctgatttgtttgaaat |
8152790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 371
Target Start/End: Complemental strand, 8153764 - 8153706
Alignment:
| Q |
313 |
gcttgagtctatggtagggtttaatatgagaaagttgagttctttcttatcataggaaa |
371 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153764 |
gcttgagtctatggtgggatttagtatgagaaagttgagttctttcttatcataggaaa |
8153706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 331 - 395
Target Start/End: Complemental strand, 4833929 - 4833865
Alignment:
| Q |
331 |
gtttaatatgagaaagttgagttctttcttatcataggaaagtttaaccaataccatagatataa |
395 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| || |||||||| ||||| ||||||||||||| |
|
|
| T |
4833929 |
gtttaatatgggaaagaaaagttctttcttatgatgggaaagttcaaccacaaccatagatataa |
4833865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University