View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18148_low_16 (Length: 205)
Name: NF18148_low_16
Description: NF18148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18148_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 6496923 - 6497099
Alignment:
| Q |
14 |
taatactcaattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtat-ttacatgaatatgactgaaattaatccaacaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6496923 |
taatactcaattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtatattacatgaatatgactgaaattaatccaacaact |
6497022 |
T |
|
| Q |
113 |
accgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497023 |
accgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatct |
6497099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 189
Target Start/End: Original strand, 6514384 - 6514458
Alignment:
| Q |
115 |
cgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatct |
189 |
Q |
| |
|
|||||| | |||| ||||||||||| ||||||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
6514384 |
cgaggaaatagctgtgtatttgaagccccattgactgattcttgagcagaactatgacctgacgatttcatatct |
6514458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University