View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18148_low_3 (Length: 416)
Name: NF18148_low_3
Description: NF18148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18148_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 211
Target Start/End: Complemental strand, 3041345 - 3041144
Alignment:
| Q |
10 |
agaagaatcaagttgtgggatggcctccggtgtgttcgtaccggaagaagaacatgaatgaaggttcaaaaatgtacatgaaggttagcatggatggagc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3041345 |
agaagaatcaagttgtgggatggcctccggtgtgttcgtaccggaagaagaatatgaatgaaggttcaaaaatgtacatgaaggttagcatggatggagc |
3041246 |
T |
 |
| Q |
110 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtggaattggtgagtta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3041245 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtggaattggtgagtta |
3041146 |
T |
 |
| Q |
210 |
ca |
211 |
Q |
| |
|
|| |
|
|
| T |
3041145 |
ca |
3041144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 269 - 397
Target Start/End: Complemental strand, 3041085 - 3040957
Alignment:
| Q |
269 |
ggatatgcatgcaaaatatttagggcacaagatatattatcaagcaaaatatatataacatcaaattgtannnnnnnnnnnngttgttgaagagatatat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3041085 |
ggatatgcatgcaaaatatttagggcacaagatatattattaagcaaaatatatataacatcaaattgtattttttctttttgttgttgaagagatatat |
3040986 |
T |
 |
| Q |
369 |
cggcaaatgttagtgaatttagtggtccc |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3040985 |
aggcaaatgttagtgaatttagtggtccc |
3040957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University