View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18149_low_14 (Length: 256)
Name: NF18149_low_14
Description: NF18149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18149_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 23770378 - 23770605
Alignment:
| Q |
13 |
aatatgaactagcttgctcaacataaaggcttggtatgattttccatggatttgtctaagacatctgaaaagttctgtatttatgatctataaaaaacac |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
23770378 |
aataggaactagcttgctcaacataaaggcttggtatgattttccatggatttgtctaagacatctgaaaagttctgtatttatgatctataaaacatac |
23770477 |
T |
 |
| Q |
113 |
aaatcaaattttaatgagataa---taagctagtataagtaagtgatgccatgaactttgacaaatacnnnnnnntaacaagaaaattaaaatacttcat |
209 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||| ||| | |||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23770478 |
aaatgaaattttaatgagataatagtaacctag--taactttgtgaagccatgaactttgacaaatacaaaaaaataacaagaaaattaaaatacttcat |
23770575 |
T |
 |
| Q |
210 |
tctgcaatctctccattgcagcttgcttat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23770576 |
tctgcaatctctccattgcagcttgcttat |
23770605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University