View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18149_low_19 (Length: 237)
Name: NF18149_low_19
Description: NF18149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18149_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 27576159 - 27576377
Alignment:
| Q |
1 |
tgtgagcgatgtcagtattaagcctacttaaaaacatagtaggactaatatggcaaaccaaccttatgttatgggcaccttgtgcaaactatgtgcttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27576159 |
tgtgagcgatgtcagtattaagcctacttaaaaacatagtaggactaatatggcaaaccaaccttatgttatgggcaccttgtgcaaactatgtgcttaa |
27576258 |
T |
|
| Q |
101 |
actacaatgtacggctaaaatctccctcaaaagttttaacatatagttaacttatctcattaatagaaaacatgctatttaatattccttgtgaccgtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27576259 |
actacaatgtacggctaaaatctccctcaaaagttttaacatatagttaacttatctcattaatagaaaacatgctatttaatattccttgtgaccgtag |
27576358 |
T |
|
| Q |
201 |
attgcaaataagatttata |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27576359 |
attgcaaataagatttata |
27576377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University