View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18149_low_20 (Length: 235)
Name: NF18149_low_20
Description: NF18149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18149_low_20 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 46 - 218
Target Start/End: Original strand, 52545 - 52717
Alignment:
| Q |
46 |
tgtataaaaaccaaggccgaataacataacctgcaattaagaaatttggaaaatatgaaatttatatgtatcaaataacttcattaaagcaaagatcaac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52545 |
tgtataaaaaccaaggccgaataacataacctgcaattaagaaatttggaaaatatgaaatttatatgtatcaaataacttcattaaagcaaagatcaac |
52644 |
T |
 |
| Q |
146 |
cttaataggtagcatgtaaggtccatgaatatcgtgtttatgaaaattagttttattatccaaaaagtttaac |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
52645 |
cttaatatgtagcatgtaaggtccatgaatattgtgtttatgaagattagttttgttatccaaaaagtttaac |
52717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University