View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18149_low_21 (Length: 229)
Name: NF18149_low_21
Description: NF18149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18149_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 35340097 - 35340294
Alignment:
| Q |
16 |
agaggtaaggttagttaaatcttgaaatccatttggaatagtgccattgagataattgatagagagatcaagctcagtcaagtttttcaatgtggtgaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340097 |
agaggtaaggttagttaaatcttgaaatccattaggaatagtgccattgagataattgatagagagatcaagctcagtcaagtttttcaatgtggtgaat |
35340196 |
T |
 |
| Q |
116 |
tcatttggaatcacgccggttaacttgttctgaaagagatgaagcagccgcaagccttttatattaactaactcgatcggtatctctcctgtaagaag |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35340197 |
tcatttggaatcacaccggttaacttgttctgaaagagatgaagcagccgcaagccttttatattaaccaactcgatcggtatctctcctgtaagaag |
35340294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University