View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18150_high_1 (Length: 288)
Name: NF18150_high_1
Description: NF18150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18150_high_1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 288
Target Start/End: Complemental strand, 10258907 - 10258641
Alignment:
| Q |
19 |
atgaaggccctccaattctttaggaacgctcatagatttgcgttcaggtgaagcaattgttcctatttcggcattcaccggaacaagagcaccacttttg |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258907 |
atgaaggccctctaattctttaggaacgcacatagatttgcgttcaggtgaagcaaccattcctatttcggcattcaccggaacaagagcaccacttttg |
10258808 |
T |
|
| Q |
119 |
ctatctagacccaaaaattgatctttatcgaaggaaagatttctagagggcaactgcattgcccattggaccactgaaatccgacgaaacaatgatcttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10258807 |
ctatctagacccaaaaattgatctttatcaaaggaaagatttctagagggcaactgcattgcccattggaccactgaaatccgacgaaacaacgatcttt |
10258708 |
T |
|
| Q |
219 |
cagaaactttcttgtctgatgatgaaattgcacgatgtagtagtggccaaccaggttttaaatcagttac |
288 |
Q |
| |
|
||||||||||| |||| ||| ||||||| |||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10258707 |
cagaaactttcctgtc---tgacgaaattgtacgatggagtagtggccaaccaggttttaaagcagttac |
10258641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University