View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18151_high_7 (Length: 481)
Name: NF18151_high_7
Description: NF18151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18151_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 9e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 316 - 466
Target Start/End: Original strand, 41796285 - 41796433
Alignment:
| Q |
316 |
gtgtctaaaattgtcaaatgatgtttataattgggatggaacttggaagtggtaccatatgtccttgcaaagccaacgggggtatatagaaatcttaccc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796285 |
gtgtctaaaattgtcaaatgatgtttataattgggatggaacttggaagtggtaccatatgtccttgcaaagccaacgggggtatatagaaatcttaccc |
41796384 |
T |
|
| Q |
416 |
tgaaacagagaatcgtataaaactatagacatagatatggtagaaaataat |
466 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41796385 |
tcaaacagagaatcgtataaaactatagac--agatatggtagaaaataat |
41796433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University