View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18151_low_14 (Length: 293)
Name: NF18151_low_14
Description: NF18151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18151_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 282
Target Start/End: Original strand, 506203 - 506469
Alignment:
| Q |
16 |
gaaacaactgatttggaacagatacagtagcccaacaagaattgtggtcctaaccagtgtgtgtattatactaaaggtgttattaggtttggacaacagt |
115 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
506203 |
gaaacaattgatttggaacagatgcagtagcccaacaagaattgtggtcctaaccagtgtgtgtattatactaaaggtgttattaggtttggagaacagt |
506302 |
T |
 |
| Q |
116 |
ttgttgtatcaatcaactgccatatacttttcatatcagattcagaactctgatccctatgaaagagtcttcttttaagtggggtttttgtagaggttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506303 |
ttgttgtatcaatcaactgccatatacttttcatatcagattcagaactctgatccctctgaaagagtcttcttttaagtggggtttttgtagaggttta |
506402 |
T |
 |
| Q |
216 |
agtgattctgggaccattacaagactctcagacaagtgatgttttgatgtgaagtaacctcattcat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506403 |
agtgattctgggaccattacaagactctcagacaagtgatgttttgatgtgaagtaacctcattcat |
506469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University