View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18152_low_7 (Length: 236)
Name: NF18152_low_7
Description: NF18152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18152_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 88 - 221
Target Start/End: Original strand, 41801671 - 41801804
Alignment:
| Q |
88 |
acaataaccgaacaagaaagaaaaagtgtgtgccactgtgtcttctaaaattgtgttttcatttatttctcctatgcctcaaaatttaatgtagacaata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41801671 |
acaataaccgaacaagaaagaaaaagtgtgtgccactgtgtcttctaaaattgtgttttcatttacttctcctatgcctcaaaatttaatgtagacaata |
41801770 |
T |
|
| Q |
188 |
accaaacaagaaagaagtaaaggctagttgtcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41801771 |
accaaacaagaaagaagtaaaggctagttgtcac |
41801804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 88 - 203
Target Start/End: Complemental strand, 3382694 - 3382580
Alignment:
| Q |
88 |
acaataaccgaacaagaaagaaaaagtgtgtgccactgtgtcttctaaaattgtgttttcatttatttctcctatgcctcaaaatttaatgtagacaata |
187 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| |||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3382694 |
acaataaccgaagaagaaagaaaaagcttgtgc-actgtgtctttagaatttttgttttcatttatttctcctatgcctcaaaatttaatgtagacaata |
3382596 |
T |
|
| Q |
188 |
accaaacaagaaagaa |
203 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
3382595 |
acctaacaagaaagaa |
3382580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University