View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18153_high_24 (Length: 406)
Name: NF18153_high_24
Description: NF18153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18153_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 17 - 396
Target Start/End: Complemental strand, 28127713 - 28127334
Alignment:
| Q |
17 |
agaatcaattggatgcagtgttggccataggctctgatgcttctccaatgttggcaattggagggtatccagcaatcactgtcccagctggatatgataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28127713 |
agaatcaattggatgcagtgttggccataggctctgatgcttctccaatgttggcaattggagggtatccagcaatcactgtcccagctggatatgataa |
28127614 |
T |
|
| Q |
117 |
gcaagggatgccatttggaatctgttttggagggttaaagggaactgagccgaaactgattgagattgcttatgattttgagcaagctaccagggcaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28127613 |
gcaagggatgccatttggaatctgttttggagggttaaagggaactgagccgaaactgattgagattgcttatgattttgagcaagctaccagggcaagg |
28127514 |
T |
|
| Q |
217 |
aagccacccctcgcttagtcgcttttcattcatacgaagaaatttaaggataatattaggacctagacttgactgatggatttctggtgattgtggattt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28127513 |
aagccacccctcgcttagtcgcttttcattcatacgaagaaatttaaggataatattaggacctagacttgactgatggatttctggtgattgtggattt |
28127414 |
T |
|
| Q |
317 |
gattaatacaagtacaatatcacatatttagttatcacttatgtgtaccttattattttttaccattatatcatcctatg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
28127413 |
gattaatacaagtacaatatcacatatttagttatcacttatgtgtactttattattttttaccattatgtcatcctatg |
28127334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 28109187 - 28109013
Alignment:
| Q |
17 |
agaatcaattggatgcagtgttggccataggctctgatgcttctccaatgttggcaattggagggtatccagcaatcactgtcccagctggatatgataa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| || ||||| || |||||||||||||||| ||||||||||| ||||| || ||||||| |
|
|
| T |
28109187 |
agaatcaattggatgcagtgttggccataggttctgatgctacttcaatgctgtcaattggagggtatcctgcaatcactgtaccagcagggtatgatag |
28109088 |
T |
|
| Q |
117 |
gcaagggatgccatttggaatctgttttggagggttaaagggaactgagccgaaactgattgagattgcttatga |
191 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28109087 |
gcaaggaatgccatttgggatctgttttggagggttaaagggaactgagccaaaactgattgagattgcttatga |
28109013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 203
Target Start/End: Complemental strand, 34919780 - 34919653
Alignment:
| Q |
73 |
attggagggtatccagcaatcactgtcccagctggatatgataagcaagggatgccatttggaatctgttttggagggttaaagggaactgagccgaaac |
172 |
Q |
| |
|
|||||||| ||||| | ||||| ||| ||||| |||||||| ||| || | |||||||||||| ||||||||||| || || || | |||||||| |
|
|
| T |
34919780 |
attggaggttatcctggaatcattgttccagcaggatatgaaaag---ggtaagccatttggaatttgttttggaggtttgaaaggctcagagccgaagt |
34919684 |
T |
|
| Q |
173 |
tgattgagattgcttatgattttgagcaagc |
203 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |
|
|
| T |
34919683 |
tgattgaaattgcttattcatttgagcaagc |
34919653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University