View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18153_high_41 (Length: 324)
Name: NF18153_high_41
Description: NF18153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18153_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 15 - 307
Target Start/End: Complemental strand, 35128013 - 35127721
Alignment:
| Q |
15 |
catcatcaagcttatgtggtgaaggttcctcctcagagaaataatcagtgctgtctttctcagaaccattgtactggatgacatcgttggcatcacttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128013 |
catcatcaagcttatgtggtgaaggttcctcctcagagaaataatcagtgctgtctttctcagaaccattgtactggatgacatcgttggcatcacttga |
35127914 |
T |
 |
| Q |
115 |
atgtgataattccggctcgaactcctcgttcacagccctttgcccataatcattatccaatatgacactttcctcgctaacatcaaccatttcattgtct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35127913 |
atgtgataattccggctcgaactcctcgttcacagccctttgcccataatcattatccaatatcacactttcctcactaacatcaaccatttcattgtct |
35127814 |
T |
 |
| Q |
215 |
ctctttgcttcatcctcttcattcaaatctgtaatatcactatcttgcttgaaacgcacgtcttcaagtagcagtggaccctgtccttgataa |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35127813 |
ctctttgcttcatcctcttcattcaaatctgtaatatcactatcttgcttgaaacgcacgtcttcaagtagcagtggaccctgtccttgataa |
35127721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University