View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18153_low_54 (Length: 252)
Name: NF18153_low_54
Description: NF18153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18153_low_54 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 33265803 - 33266036
Alignment:
| Q |
18 |
atttttaataacagtagttgtattgttattagatcatattaa-gtgtctttgtgagaatggtaattggctaagtctacggttaggtattgtttgtacttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33265803 |
atttttaataacagtagttgtattgttattagattatattaaagtgtctttgtgagaatggtaattggttaagtctacggttaggtattgtttgtacttt |
33265902 |
T |
 |
| Q |
117 |
gagagtggtgtgactcatctagagtgtttggatagaaattagnnnnnnnnnctttctgcattggatggttgggggttaactataactagtcttatgtata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
33265903 |
gagagtggtgtgactcatctagagtgtttggctagaaattagtttttttt--tttgtgcattggatggttgggggttaactataactagtcttaagtgta |
33266000 |
T |
 |
| Q |
217 |
tgggttggaatatcattggtactctctatattttat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33266001 |
tgggttggaatatcattggtactctctatattttat |
33266036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University