View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18153_low_55 (Length: 251)
Name: NF18153_low_55
Description: NF18153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18153_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 233
Target Start/End: Complemental strand, 9977480 - 9977264
Alignment:
| Q |
17 |
aaaatactataagccgatcgagtgatattaagcaagcagatcagacttgccaaggagaacatttatctttgcaattattaaatgtatctcttccaaacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9977480 |
aaaatactataagccgatcgagtgatattaagcaagcagatcagacttgccaaggagaacatttatctttacaattattaaatgtatctcttccaaacta |
9977381 |
T |
 |
| Q |
117 |
attttttccatttttgccaaacatgcttatgctgtgctgtgttctcaggtgaaggtttgcaacgggaaagtggtgcacgttgaggcttgcagaaaggggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9977380 |
attttttccatttttgccaaacatgcttatgctgtgctgtgttctcaggtgaaggtttgcaacgggaaagtggtgcacgttgaggcttgcagaaaggggt |
9977281 |
T |
 |
| Q |
217 |
tttacagtgttgggaag |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9977280 |
tttacagtgttgggaag |
9977264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University