View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18153_low_64 (Length: 226)

Name: NF18153_low_64
Description: NF18153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18153_low_64
NF18153_low_64
[»] chr5 (1 HSPs)
chr5 (131-206)||(32292858-32292933)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 131 - 206
Target Start/End: Complemental strand, 32292933 - 32292858
Alignment:
131 caattgataagctttattttatgtaaaaaacagttgttttttagtgttgggttatgctaacaagtggatcacttgt 206  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32292933 caattgataaattttattttatgtaaaaaacagttgttttttagtgttgggttatgctaacaagtggagcacttgt 32292858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University