View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18155_high_10 (Length: 241)
Name: NF18155_high_10
Description: NF18155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18155_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 35 - 229
Target Start/End: Original strand, 32826454 - 32826650
Alignment:
| Q |
35 |
ctaaatgtagcatttgcttgacaagttgaacattgcccaagtctgagtagaagaggaagaaaagctttcctaacacagtaacatgtgactgacaatgacc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32826454 |
ctaaatgtagcatttgcttgacaagttgaacattgcccaagtctgagtagaagaggaagaaaagctttcctaacacagtaacatgtgactgacaatgacc |
32826553 |
T |
 |
| Q |
135 |
aaacatgtctaacacagcaatgtattttcacta-ttttttgtaaaagcaatgtattgttgttactttcaa----aaggaatttcatattttactgtttaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32826554 |
aaacatgtctaacacagcaatgtattttcactatttttttgtaaaagcaatgta---ttgttactttcaaatccaaggaatttcaaattttactgtttaa |
32826650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University