View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18155_low_11 (Length: 244)
Name: NF18155_low_11
Description: NF18155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18155_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 32827172 - 32827053
Alignment:
| Q |
1 |
tgataatctggatgcatcggtcacttatacaaatccaaaagttctaagtaatttcggcattgtaaaatgccttgaacttttggcataaattcaaaggtgc |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32827172 |
tgatagtctggatgcatcggtaacttatacaagtccaaaagtccaaagtaatttcggcattgtaaaatgccttgaactttttgcataaattcaaaggtgc |
32827073 |
T |
|
| Q |
101 |
tagttggatatgagattaac |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32827072 |
tagttggatatgagattaac |
32827053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 32827019 - 32826935
Alignment:
| Q |
160 |
aagctggatgaaaatgttcagggagtgaagagacttgatagataaaagcccaaagcaaatatatttgtatttaaacaattcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
32827019 |
aagctggatgaaaatgttcagggagtgaagagacttgatagataaaagcccaaggcatatatatttgtatttaaacaattcttct |
32826935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 9 - 120
Target Start/End: Complemental strand, 32827358 - 32827248
Alignment:
| Q |
9 |
tggatgcatcggtcacttatacaaatccaaaagttctaagtaatttcggcattgtaaaatgccttgaacttttggcataaattcaaaggtgctagttgga |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| | ||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
32827358 |
tggatgcatcggtcacttatacaagatcaaaagtccta-gcaatttcggcattgtaaaatgcgttgaacttttcgcataaatccaaaggtgctagctgga |
32827260 |
T |
|
| Q |
109 |
tatgagattaac |
120 |
Q |
| |
|
||||||| |||| |
|
|
| T |
32827259 |
tatgagaataac |
32827248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University