View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18155_low_9 (Length: 345)
Name: NF18155_low_9
Description: NF18155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18155_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 49 - 306
Target Start/End: Original strand, 1288037 - 1288275
Alignment:
| Q |
49 |
atttatatatcgtttggaattcattccaactaatcaattattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288037 |
atttatatatcgtttggaattcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata |
1288136 |
T |
 |
| Q |
149 |
cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgacggtcatggacagatggctctgttcgaacaccaagtgtgtttg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1288137 |
cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgacg-------------------gttggaacaccaagtgtgtttg |
1288217 |
T |
 |
| Q |
249 |
tgtgaattgaaaaattactatgtcccatatcaggtagattatacacacaatattagtg |
306 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1288218 |
tgtgaattgaaaaattattatgtcccatatccggtagattatacacacaatattagtg |
1288275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University