View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_high_33 (Length: 369)
Name: NF18156_high_33
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 18 - 355
Target Start/End: Complemental strand, 6131593 - 6131256
Alignment:
| Q |
18 |
gttctatatggttttagatataaaaatatatattattgtgatggaggtatgaccatatgtctgttatgtatggggaatgctttgggaaggataatttggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131593 |
gttctatatggttttagatataaaaatatatattattgtgatggaggtatgatcatatgtctgttatgtatggggaatgctttgggaaggataatttggt |
6131494 |
T |
 |
| Q |
118 |
gtgtgtagtgggaaatggtgaaaatactctattttggagacatttttgttggagggtcgttctcttggcgaaggtttttcacggttttatagtgtttcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131493 |
gtgtgtagtgggaaatggtgaaaatactctatttcggagacatttttgttggagggtcgttctcttggcgaaggtttttcacggttttatagtgtttcta |
6131394 |
T |
 |
| Q |
218 |
atgtttaagatgtcattgttgcgaataaatttagattacgggagtgggttataattggaggagaagattatttgtttgtgaagaagaaagtcttttggaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131393 |
atgtttaagatgtcattgttgcgaataaatttagattacgggagtgggttataattggaggagaagattatttgtttgtgaagaagaaagtcttttggaa |
6131294 |
T |
 |
| Q |
318 |
tgtatgcattgcttgttaatgtgattttgcagaataat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6131293 |
tgtatgcattgcttgttaatgtgattttgcaggataat |
6131256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University