View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_high_38 (Length: 349)
Name: NF18156_high_38
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 32 - 345
Target Start/End: Original strand, 6339383 - 6339696
Alignment:
| Q |
32 |
tcgtcgtacggaacccttgaagttggggcttgtttagggcccaatcacgtggtccatttttgttccattgtcaccgactttcaattccagatttgccctt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6339383 |
tcgtcgtacggaacccttgaagttggggcttgtttagggcccaatcacgtggtccatctttgttccattgtcaccgactttcaattccagatttgccctt |
6339482 |
T |
 |
| Q |
132 |
attccgtttttcttaatcaccctcaaacaaatgtacttgttgtcatgctgaatttgaattcacatttgaggcttgcaagtagccagaagcaacgatcaaa |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6339483 |
attccgtttttcttaattaccctcaaacaaatgtacttgttgtcatgctgaatttgaattcacatttgaggcttgcaagtagccagaagcaacgatcaaa |
6339582 |
T |
 |
| Q |
232 |
caataaacaattttcatgtgaaattatgatactattnnnnnnntcattttgagtccaacaacaatgtgcctcgatctattgcctattattatttttgtgt |
331 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6339583 |
caataaacaattttcatgtaaaattatgatactattaaaaaaatcattttgagtccaacaacaatgtgcctcgatctattgcctattattatttttgtgt |
6339682 |
T |
 |
| Q |
332 |
cagtattatctacc |
345 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
6339683 |
cagttttatctacc |
6339696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University