View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_high_52 (Length: 250)
Name: NF18156_high_52
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 169
Target Start/End: Complemental strand, 32169647 - 32169494
Alignment:
| Q |
13 |
atactacaggaataatgtttgaaaatgatttaattaaaactccaacaaccattgaccagtccagtcggtgttatttgtattgttgttcagttataataaa |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
32169647 |
atactacagcaataatgtttgaaaatgatttaattaaaactccaacaaccattgaccagtccagtcggtgttatatgtattgttgttcacttataataaa |
32169548 |
T |
 |
| Q |
113 |
gttgggtcttgacaacgagtgtctcataagactctttaaagattctaaattaagaaa |
169 |
Q |
| |
|
|| |||||||| |||||||||||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
32169547 |
-ttaggtcttgataacgagtgtctcataatactcttt--agattctaaaataagaaa |
32169494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 32169467 - 32169424
Alignment:
| Q |
193 |
ttttaatttttaatatactttacacaaacttttatacaatgtta |
236 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
32169467 |
ttttaattttcaatacactttacataaacttttatacaatgtta |
32169424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University