View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_41 (Length: 352)
Name: NF18156_low_41
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 38200232 - 38200474
Alignment:
| Q |
1 |
ttgggctggcgtgtttgtgaggacgcgtgatgaaatgaaatgacttatgcaatgcatcattcaagattaccgtccttttcgtccccaccacttaacacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38200232 |
ttgggctggcgtgtttgtgaggacgcgtgatgaaatgaaatgacttatgcaatgcatcattcaagattaccgtccttttcgtccccaccacttaacacgg |
38200331 |
T |
 |
| Q |
101 |
acgctttctcaagtctcttaaatcnnnnnnnnnnngtcaagatccaactagat-caattaatgcatttctaaaacacnnnnnnnnnngtcaagatctaat |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38200332 |
acgctttctcaagtctcttaaatc-ttttttttttgtcaagatccaactagatccaattaatgcatttctaaaacacttttttttttgtcaagatctaat |
38200430 |
T |
 |
| Q |
200 |
taatgcatttctaaaacactcttaaaatttaagatcctctccat |
243 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38200431 |
taatgcatttctaaaacacacttaaaatttaagatcctctccat |
38200474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University