View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_54 (Length: 268)
Name: NF18156_low_54
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_54 |
 | |
|
| [»] scaffold0021 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 262
Target Start/End: Complemental strand, 29586608 - 29586363
Alignment:
| Q |
17 |
acaaagcaattcagatgcggttctttccaatgtatcacgaaatggtacagtggataaggtatgaagggaagaccgaggatcccgagtactgtgctatggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
29586608 |
acaaagcaattcagatgcggttctttccaatgtatcacgaaatggtacagtggataaggtatgaagggaagactgaggatcctgagtactgtgctatggt |
29586509 |
T |
|
| Q |
117 |
ccggcaaatatcattgcagccaatgactgtcggttcaactgctcgcttagctgccaaggcaaaccaattgtcggacaaaattattaaacatagataatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586508 |
ccggcaaatatcattgcagccaatgactgtcggttcaactgctcgcttagctgccaaggcaaaccaattgtcggacaaaattattaaacatagataatat |
29586409 |
T |
|
| Q |
217 |
attttgatatattattgtttcggtcatgaaatcacgtagtctgtgc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586408 |
attttgatatattattgtttcggtcatgaaatcacgtagtctgtgc |
29586363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 89
Target Start/End: Original strand, 155940 - 156000
Alignment:
| Q |
29 |
agatgcggttctttccaatgtatcacgaaatggtacagtggataaggtatgaagggaagac |
89 |
Q |
| |
|
|||||| |||||||||| | ||||| || ||| |||| |||||||||||||| |||||||| |
|
|
| T |
155940 |
agatgcagttctttccattttatcatgagatgatacaatggataaggtatgaggggaagac |
156000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University