View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_59 (Length: 242)
Name: NF18156_low_59
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 184
Target Start/End: Original strand, 39099125 - 39099299
Alignment:
| Q |
10 |
attattctacagtaaaagattgacgagtagattaatgtagtttaaagttttaattatactttaaatactgttaataagcatatgatatgatatgatgaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099125 |
attattctacagtaaaagattgacgagtagattaatgtagtttaaagttttaattatactttaaatactgttaataagcatatgatatgatatgatgaca |
39099224 |
T |
 |
| Q |
110 |
ttgactgttactgttagtatcaaatgatttctgtcacccaagcatttcaatctaggagagaatttacattctttc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099225 |
ttgactgttactgttagtatcaaatgatttctgtcacccaagcatttcaatctaggagagaatttacattctttc |
39099299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 99
Target Start/End: Original strand, 39603717 - 39603791
Alignment:
| Q |
25 |
aagattgacgagtagattaatgtagtttaaagttttaattatactttaaatactgttaataagcatatgatatga |
99 |
Q |
| |
|
|||||||| |||||||||||||||| |||| ||| ||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
39603717 |
aagattgattagtagattaatgtagtctaaactttcaattatattttaaacactgttaataggcatatgatatga |
39603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 100 - 143
Target Start/End: Original strand, 39603953 - 39603996
Alignment:
| Q |
100 |
tatgatgacattgactgttactgttagtatcaaatgatttctgt |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
39603953 |
tatgatgatattgactgttactgttagtatcaactgatttctgt |
39603996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University