View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_60 (Length: 237)
Name: NF18156_low_60
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 89 - 222
Target Start/End: Original strand, 16648121 - 16648254
Alignment:
| Q |
89 |
acaatggttacaatggagctgagcaatactcaagagatcatttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattgattatg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16648121 |
acaatggttacaatggagctgagcaatactcaagagatcatttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattaattatg |
16648220 |
T |
|
| Q |
189 |
aaaggtaattgattatgaaacctttcacttttct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16648221 |
aaaggtaattgattatgaaacctttcacttttct |
16648254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University