View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_70 (Length: 227)
Name: NF18156_low_70
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 44736189 - 44736413
Alignment:
| Q |
1 |
cagcaatataactaaattannnnnnncatgaaatgaaatttgcgtacatcattcttagaaactaaattggatattgcagtttttctcaaagattaaaacg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44736189 |
cagcaatataactaaattatttttttcatgaaatgaaatttgcttacatcattcttagaaactaaattggatattgcagtttttctcaaagattaaaacg |
44736288 |
T |
|
| Q |
101 |
actcatcactctttaagtgtttttatggctcaattcgtaattttgaggttattgttacttcaacaannnnnnnaacactcgtatgattaaaaaagtcttc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
44736289 |
actcatcactctttaattgtttttatggctcaattcgtaattttgaggttattgttacttcaacaatttttttaacactcgtatgattaaaaaagacttc |
44736388 |
T |
|
| Q |
201 |
tttaataactgttcttctcactcga |
225 |
Q |
| |
|
|||||||||||||||| || ||||| |
|
|
| T |
44736389 |
tttaataactgttcttttctctcga |
44736413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University