View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18156_low_73 (Length: 212)
Name: NF18156_low_73
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18156_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 1554673 - 1554848
Alignment:
| Q |
20 |
acatatgccttaccatccatcttggcaattccaaatcgcttttgcagcttggtaagtgtcattctcatgactaaagtgtcccctgcaatcacgagcttac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1554673 |
acatatgccttaccatccatcttggcaattccaaatcgcttttgcagcttggtaagtgtcattctcatgactaaagtgtcccctgcaatcacgggcttac |
1554772 |
T |
|
| Q |
120 |
gaaatcgcactttgtctattctggcaaagaagaagtttgcacgagaaccacccacatcagaatgcaacattaccaa |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
1554773 |
gaaatcgcactttgtctattccggcaaagaagaagtttgcacgagaaccaccgacatcaggatgcaacattaccaa |
1554848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 24 - 153
Target Start/End: Complemental strand, 37575310 - 37575181
Alignment:
| Q |
24 |
atgccttaccatccatcttggcaattccaaatcgcttttgcagcttggtaagtgtcattctcatgactaaagtgtcccctgcaatcacgagcttacgaaa |
123 |
Q |
| |
|
||||||| || |||||||| || |||||||||||||||||||| ||| |||||||||||||||| |||| ||||| || |||||||| |||| | ||| |
|
|
| T |
37575310 |
atgccttcccttccatctttgctattccaaatcgcttttgcagtttgataagtgtcattctcataactagggtgtctccagcaatcactggcttcctaaa |
37575211 |
T |
|
| Q |
124 |
tcgcactttgtctattctggcaaagaagaa |
153 |
Q |
| |
|
||| ||||||||||| | ||||||||||| |
|
|
| T |
37575210 |
tcgtactttgtctatcccagcaaagaagaa |
37575181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University