View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_high_25 (Length: 337)
Name: NF18157_high_25
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 8 - 319
Target Start/End: Original strand, 30941901 - 30942212
Alignment:
| Q |
8 |
gacatcatcaagatacggctcgaagaaccagtagaagctcgaaagacatcacctttgacatcaagccgagtctccaacagcgagtccttaacacccaaca |
107 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941901 |
gacatcctcaagatacggctagaagaaccagtagaagctcgaaagacatcgcctttgacatcaagccgagtctccaacagcgagtccttaacacccaaca |
30942000 |
T |
 |
| Q |
108 |
taaaaaagccaatagtttcgtcattggcaccggttgggaagataacaacagcttttggggtattcgggcatttaagaagttgaatgcggttgtgaaggaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942001 |
taaaaaagccaatagtttcgtcattggcaccggttgggaagataacaacagcttttggggtattcgggcatttaagaagttgaatgcggttgtgaaggaa |
30942100 |
T |
 |
| Q |
208 |
atgagaaacattgtcatcatcgagttcaggagtagaatcaaatagacgggcaatagtggaagcagtggagggcagaatggaagggtcggaggttaaaagg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30942101 |
atgagaaacattgtcatcatcgagttcaggagtagaatcaaatagatgggcaatagtggaagcagtggaggggagaatggaagggtcggaggttaaaagg |
30942200 |
T |
 |
| Q |
308 |
tagcgttcggtt |
319 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30942201 |
tagcgttcggtt |
30942212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University