View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_high_39 (Length: 241)
Name: NF18157_high_39
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 33115806 - 33115867
Alignment:
| Q |
1 |
attatactgcaatactaaatatggactaaattagtacttctgatttatcataattttctgtg |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
33115806 |
attatactgcaatactaaatatggactaaattaatacttctgatttatcatagttttctgtg |
33115867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 156 - 227
Target Start/End: Original strand, 33116098 - 33116165
Alignment:
| Q |
156 |
actgtcagctacaaatcatattgacttgactttatcccatgcatggcacttctttcgaagttgcaaccaaca |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33116098 |
actgtccgctacaaatcatattgacttgactttatcc----catggcacttctttctaagttgcaaccaaca |
33116165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 73 - 122
Target Start/End: Original strand, 33115984 - 33116033
Alignment:
| Q |
73 |
ttctctctattgttttgattttcttatcaatagttattccaaaagttatc |
122 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
33115984 |
ttctctccattgttttgattttcttattaatatttattccaaaagttatc |
33116033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University