View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_high_43 (Length: 236)
Name: NF18157_high_43
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 36771491 - 36771703
Alignment:
| Q |
16 |
ttgcttgttgaagacccaaatattagtctattatgtctcacttatataagtcggaagggg-tcatactaaagttgcaaggagagagtattttggtgagga |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36771491 |
ttgctttttgaagacccaaatattagtctattatgtctcacttatataagtcggaagggggtcatactaaagttgcaaggagagagtattttggtgagga |
36771590 |
T |
 |
| Q |
115 |
gaacaaccatcaaaaagggaaaagaagagcgaaaacaattccccnnnnnnnggttcaccgttggattgtgcaaatttttgaagagcaggtttgcatcact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36771591 |
gaacaaccatcaaaaagggaaaagaagagcgaaaacaattcccgtttttttcgttcaccgttggactgtgcaaatttttgaagagcaggtttgcatcact |
36771690 |
T |
 |
| Q |
215 |
tgtttcttcattt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36771691 |
tgtttcttcattt |
36771703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University