View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_high_44 (Length: 232)
Name: NF18157_high_44
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_high_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 24709767 - 24709971
Alignment:
| Q |
20 |
aaggccacatttgtaccctctacacttcgttttaattctcatctctgtgctttttatggctgcacaatcacaattggaggcctcacatatgaattagaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24709767 |
aaggccacatttgtaccctctacacttcgttttaattctcatctctgtgctttttatggctgcacaatcacaattggaggcctcacatataaattagaca |
24709866 |
T |
 |
| Q |
120 |
aaaggatcccacatgctttgatgcacaggtatagaagattttcaagttacagaagaacaagcacgcaatgatggcacatgtcaatgatgctatattcttc |
219 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24709867 |
acaggatcccacatgctttgatgcactggtatagaagattttcaagttatagaagaacatccacgcaatgatggcacatgtcaatgatgctatattgttc |
24709966 |
T |
 |
| Q |
220 |
gacat |
224 |
Q |
| |
|
|||| |
|
|
| T |
24709967 |
cacat |
24709971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University