View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_high_47 (Length: 211)
Name: NF18157_high_47
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 46528707 - 46528884
Alignment:
| Q |
19 |
tggtggacagagatatacaaaagggcttagtgagaagcagataacttctatgctaaaagtctcatgtcagagaccacgcgaaagggagaatgatattctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46528707 |
tggtggacagagatatacaaaagggcttagtgagaagcagataacttctatgctaaaagtctcatgtcagagaccacgcgaaagggagaatgatattctt |
46528806 |
T |
|
| Q |
119 |
caggttattgtcattttttgtttgagtttatgacgcacatacactagacatgacacttacacataaacactagtatta |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46528807 |
caggttattgccattttttgtttgagtttatgacgcacatacactagacatgacacttacacataaacactagtatta |
46528884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 154
Target Start/End: Complemental strand, 46528006 - 46527968
Alignment:
| Q |
116 |
cttcaggttattgtcattttttgtttgagtttatgacgc |
154 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
46528006 |
cttcaggttattgccattttttttttgagtttatgacgc |
46527968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University