View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_low_41 (Length: 260)
Name: NF18157_low_41
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 47950 - 47722
Alignment:
| Q |
13 |
gagacaaacgaaaattaactcggtcatcaacacattgaaaaagacacattgattttcaaatcatcttgtcatcacgagctaacaacttaggagacaactg |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47950 |
gagacaaacgaaaattaactcggccatcaacacattgaaaaagacacattgattttcaaatcatcttgtcatcacgagctaacaacttaggagacaattg |
47851 |
T |
 |
| Q |
113 |
ctttgaattgagcccagacctaaccctcagtcgaccttacttgaaggcacatgctagaacgtcacatagccagctcacttaagtatatccttctagtaat |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
47850 |
ctttgaattgggcccagacctaaccctcagtcgaccttacttgaaggcacatgctagaacgtcacatagccagctcacttaagcatatccttctggtaat |
47751 |
T |
 |
| Q |
213 |
cgatcgttgcatgatcaacatcaacggac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47750 |
cgatcgttgcatgatcaacatcaacggac |
47722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University