View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_low_50 (Length: 237)
Name: NF18157_low_50
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 30 - 223
Target Start/End: Original strand, 4822859 - 4823052
Alignment:
| Q |
30 |
gcagaatatggttatttagttaggataaaacttatctgcatctagttaagtgttttttcgtataatttttaacttgaaatatatattatgtggttaatta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822859 |
gcagaatatggttatttagttaggataaaacttatctgcatctagttaagtgttttttcgtataatttttaacttgaaatatatattatgtggttaatta |
4822958 |
T |
 |
| Q |
130 |
taataaattttgaaaagaatatgatttttgagaaaattatgtggttaatcatgaatatttttaaagagatttgaatttgtcccttgaggttact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4822959 |
taataaattttgaaaagaatatgatttttgagaaaattatgtggttaatcatgaatatttttaaagagatttgaatttgtcccttgaagttact |
4823052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University