View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_low_53 (Length: 227)
Name: NF18157_low_53
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_low_53 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 36771129 - 36771349
Alignment:
| Q |
7 |
ataacgtcgatgttgtttgatttatgagaagtccttgtgttgcaactatttaataaaattaaaacaaaattaagatgtttgatttaaatgtcaatagaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
36771129 |
ataacgtcgatgttgtttgatttatgagaagtccttgtgttgcaactatttaataaaataaaataaaaattaagaagtttgatttaaatgcaaatagaac |
36771228 |
T |
 |
| Q |
107 |
aagtccttttacttgaattttgtataactctgcaaggaaataatgcacaggatagcatatatgcagtgtttgtaatgagtatgaatacatgtgtgaagaa |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36771229 |
aagttcttttacttgaattttgtataactctgcaaggaaataatgcacaagatagcatatatgcagtgtttgtaatgagtatgaatacatgtgtgaagaa |
36771328 |
T |
 |
| Q |
207 |
tcgctactattatcttgaata |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36771329 |
tcgctactattatcttgaata |
36771349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University