View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_low_54 (Length: 221)
Name: NF18157_low_54
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 4660832 - 4660645
Alignment:
| Q |
20 |
tgggacaggtgtcaataaagtagttataaaattgatatgtgtggtctgtactttgaacaagatatatcaatttttatcgacttaaatgtctctgataaat |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4660832 |
tgggaaaggtgtcaataaagtagttataaaattgatatgtgtggtctgtattttgaacaagatatatcaatttttatcaacttaaatgtctctgataaat |
4660733 |
T |
 |
| Q |
120 |
aagatcaaaaggagtatttaattcggactcattgagtatgtatgttgaactatgatcctcttcagttatcaaaataattagacgatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
4660732 |
aagatcaaaaggagtatttaattcggactcattgagtatgtatgttgaactacgatcctcttcatttatcaaaataattatacgatat |
4660645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University