View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18157_low_56 (Length: 205)
Name: NF18157_low_56
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18157_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 22 - 145
Target Start/End: Original strand, 294339 - 294462
Alignment:
| Q |
22 |
acgaacaatttgaccgaattaaaactttacggatgaaagacatttggcaaaaatttaaatggttgagattacagaaagcaaacacatcatttttgttact |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
294339 |
acgaacaatttgaccgaattaaaactttacggatgaaagacatgtggccaaaatttgaatggttgagattaaagaaagcaaacacatcatttttgttact |
294438 |
T |
 |
| Q |
122 |
aacaaaacacaacccctacgaacc |
145 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
294439 |
aacaaaacataacccctacgaacc |
294462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University