View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18158_low_11 (Length: 211)
Name: NF18158_low_11
Description: NF18158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18158_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 1885659 - 1885478
Alignment:
| Q |
20 |
cttttccatgatgctcctgtatgcgctacgaacggaatagatactgtttttctcaagtttccacacacatctatcttgctgcgcggtagaaatcagaggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885659 |
cttttccatgatgctcctgtatgcgctacgaacggaatagatactgtttttctcaagtttccacacacatctatcttgctgcgcggtagaaatcagaggt |
1885560 |
T |
|
| Q |
120 |
gttctgcgaatttgataagctgaaatgttgtcaaataaataatattctccatctgccattgtttggtgtatcctttgcttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1885559 |
gttctgcgaatttgataagctgaaatgttgtcaaataaataatattctccatctgccattgtttggtgtatcctttgtttct |
1885478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University