View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18158_low_7 (Length: 324)
Name: NF18158_low_7
Description: NF18158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18158_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 117 - 308
Target Start/End: Complemental strand, 37214732 - 37214541
Alignment:
| Q |
117 |
gtctaaataaaaaatcaatgacaacaaacccattggaagtgagctctcaacttgataatctcaaatgtttcagtttctgttaacaagacaaagaagaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37214732 |
gtctaaataaaaaatcaatgacaacaaacccattggaagtgagctctcaacttgataatctcaaatgtttcagtttctgttaacaagacaaagaagaatg |
37214633 |
T |
|
| Q |
217 |
catgaagttctatttctgaattcaaaaaattcaaaggcccatgttataaaagaagtaatctggtaaccccctctgttgaattagataagtgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37214632 |
catgaagttctatttctgaattcaaaaaattcaaaggcccatgttataaaagaagtaatctggtaaccccctctgttgaattagataagtgt |
37214541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 37214850 - 37214800
Alignment:
| Q |
1 |
cctcaaaacctttgaggtgatatcactgaagtgattgtttgacaaattttc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37214850 |
cctcaaaacctttgaggtgatatcactgaagtgattgtttgacaaattttc |
37214800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 240
Target Start/End: Complemental strand, 31974850 - 31974768
Alignment:
| Q |
158 |
agctctcaacttgataatctcaaatgtttcagtttctgttaacaagacaaagaagaatgcatgaagttctatttctgaattca |
240 |
Q |
| |
|
|||| ||||||||||||| |||||||||| | | ||| ||||||||||||||| ||||| || || |||| |||| |||||| |
|
|
| T |
31974850 |
agctgtcaacttgataatttcaaatgttttactctctaataacaagacaaagaaaaatgcttggagatctacttctaaattca |
31974768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University