View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_high_17 (Length: 319)
Name: NF18159_high_17
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 10 - 146
Target Start/End: Original strand, 8486667 - 8486803
Alignment:
| Q |
10 |
catcacttctttccttatatttttaggtctacgagttggagaaatggaacgtgattgcttaattgcatacggtgctagtatgttgatttttgagtgactc |
109 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8486667 |
catcacttgtttccttttatgtttaggtctacgagtcggagaaatggaacgtgattgcttaattgcatatggtgctagtatgttgatttttgagcgactc |
8486766 |
T |
 |
| Q |
110 |
atgttatcccgtgattcttatgaagtccaggtaaaaa |
146 |
Q |
| |
|
|||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
8486767 |
atgttatctagtgatccttatgaagttcaggtaaaaa |
8486803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 186 - 279
Target Start/End: Original strand, 6871083 - 6871176
Alignment:
| Q |
186 |
tgtcaagtattatgggacggagggagtatcaaataacaacaacacatttgataacacgaggttcaagttgtaaaattctagttagcatgtggtt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6871083 |
tgtcaagtattatgggacggagggagtatcaaataacaacaacacatttgataacacgaggttcaagttgtaaaactctagttagcatgtggtt |
6871176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 4271843 - 4271807
Alignment:
| Q |
186 |
tgtcaagtattatgggacggagggagtatcaaataac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4271843 |
tgtcaagtattatgggacggagggagtattaaataac |
4271807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University