View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_high_20 (Length: 279)
Name: NF18159_high_20
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_high_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 15 - 279
Target Start/End: Complemental strand, 2189711 - 2189447
Alignment:
| Q |
15 |
aagaagatcctaattttggattatctgcaagccttgcttatccaacatggctaggttaaattccttgaaggttcaaaaacccagaccacctttcttcttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2189711 |
aagaagatcctaattttggattatctgcaagccttgcttatccaacatggctaggttaaattccttgaaggttcaaaaacccagaccacctttcttcttt |
2189612 |
T |
|
| Q |
115 |
tccttgctgagagaatttcactttatccaaggaatcttacgctttccttgtttgcttcgccaccaaaaactactattcatggttttggtgtgatcggaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2189611 |
tccttgctgagagaatttcactttatccaaggaatcttacgctttccttgtttgcttcgccaccaaaaactactattcatggttttggtgtgatcggaca |
2189512 |
T |
|
| Q |
215 |
atccttctggtaatttaaagcaactcatcatgtaggtggaagtcgatcgaactaccactttaatc |
279 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2189511 |
atccttcgggtaatttaaagcaactcatcatgtaggtggaagtcgatcgaactaccactttaatc |
2189447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University