View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_low_14 (Length: 387)
Name: NF18159_low_14
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_low_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 15 - 387
Target Start/End: Original strand, 22912484 - 22912856
Alignment:
| Q |
15 |
caaaggcggtgacaaatgaacgaatcagtttcgcaatcgcagctagatagagagatgccttgccttatgcacttttattaatcgcaaactcataaaagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22912484 |
caaaggcggtgacaaatgaacgaatcagtttcgcaatcgcagctagatagagagatgccttgccttatgcacttttattaatcgcaaactcataaaagct |
22912583 |
T |
 |
| Q |
115 |
tagtcctaaaagcgcttctctgaataatcaatttcgctttcgctttcgcttttgcttttccgcttagggctctccaactcgctcttttcactcagatttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22912584 |
tagtcctaaaagcgcttctctgaataatcaatttctctttcgctttcgcttttgcttttccgcttagggctctccaactcgctcctttcactcagatttc |
22912683 |
T |
 |
| Q |
215 |
tctctcacttctcaggtgcgtgcgtactctcttcgagttgactcatactcttctctacttcgatctactatcaaccttaatctcactgcttttacgcttc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22912684 |
tctctcacttctcaggtgcgtgcgtactctcttcgagttgactcatactcttctctacttcgatctactatcaaccttaatctcactgcttttacgcttc |
22912783 |
T |
 |
| Q |
315 |
aattttcagtatatgcttttcattttataatttgattccgcggaatgaaactgaaatgaaatctaacgtgttt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22912784 |
aattttcagtatatgcttttcattttataatttgattccgcggaatgaaactgaaatgaaatctaacgtgttt |
22912856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 15 - 387
Target Start/End: Complemental strand, 22966038 - 22965666
Alignment:
| Q |
15 |
caaaggcggtgacaaatgaacgaatcagtttcgcaatcgcagctagatagagagatgccttgccttatgcacttttattaatcgcaaactcataaaagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22966038 |
caaaggcggtgacaaatgaacgaatcagtttcgcaatcgcagctagatagagagatgccttgccttatgcacttttattaatcgcaaactcataaaagct |
22965939 |
T |
 |
| Q |
115 |
tagtcctaaaagcgcttctctgaataatcaatttcgctttcgctttcgcttttgcttttccgcttagggctctccaactcgctcttttcactcagatttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22965938 |
tagtcctaaaagcgcttctctgaataatcaatttctctttcgctttcgcttttgcttttccgcttagggctctccaactcgctcctttcactcagatttc |
22965839 |
T |
 |
| Q |
215 |
tctctcacttctcaggtgcgtgcgtactctcttcgagttgactcatactcttctctacttcgatctactatcaaccttaatctcactgcttttacgcttc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22965838 |
tctctcacttctcaggtgcgtgcgtactctcttcgagttgactcatactcttctctacttcgatctactatcaaccttaatctcactgcttttacgcttc |
22965739 |
T |
 |
| Q |
315 |
aattttcagtatatgcttttcattttataatttgattccgcggaatgaaactgaaatgaaatctaacgtgttt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22965738 |
aattttcagtatatgcttttcattttataatttgattccgcggaatgaaactgaaatgaaatctaacgtgttt |
22965666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University