View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_low_25 (Length: 253)
Name: NF18159_low_25
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 22323658 - 22323749
Alignment:
| Q |
8 |
aacctgtgaattaaatgcgttagaatgggagggaattattgctaggttagatttagggttagggttagcttgaccatacaagctttagtaagta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22323658 |
aacctgtgaattaaatgcgttagaatgggagggaa--attgctaggttagatttagggttagggttagcttgaccaaacaagctttagtaagta |
22323749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 22728851 - 22728756
Alignment:
| Q |
8 |
aacctgtgaattaaatgcgttagaatgggagggaattattgctaggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
22728851 |
aacctgtgaattaaatgcgttagaatgggaagtga--attgctaggttagatttagggttagggttagcttgaccagacaaactttaataagtaagat |
22728756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 33 - 105
Target Start/End: Original strand, 36434637 - 36434707
Alignment:
| Q |
33 |
tgggagggaattattgctaggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
36434637 |
tgggagggaa--attgctaggttagatttagggttagggttagcttgaccagacaaactttagtaagtaagat |
36434707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 23 - 106
Target Start/End: Complemental strand, 25184625 - 25184544
Alignment:
| Q |
23 |
tgcgttagaatgggagggaattattgctaggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagata |
106 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
25184625 |
tgcgttagaatgagagggaa--agtgctaggttaaatttagggttagggttagcttgaccagacaagctttaataagtaagata |
25184544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 42605980 - 42606064
Alignment:
| Q |
19 |
taaatgcgttagaatgggagggaattattgctaggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
||||||| |||||||| | ||||| | |||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
42605980 |
taaatgctttagaatgagcgggaa--aatgctaggttaattttagggttagggttagcttgacctgacaagctttaataagtaagat |
42606064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 106
Target Start/End: Complemental strand, 52164704 - 52164611
Alignment:
| Q |
12 |
tgtgaattaaatgcgttagaatgggagggaattattgctaggtta-gatttagggttagggttagcttgaccatacaagctttagtaagtaagata |
106 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| | ||||||||| || || ||||||||| | ||||||||| ||||||||||| ||| |||||| |
|
|
| T |
52164704 |
tgtgaattaattgcgttggaatgggagggaaaaa--gctaggttatgaattggggttagggattgcttgaccagacaagctttagaaagaaagata |
52164611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 105
Target Start/End: Complemental strand, 22964062 - 22964007
Alignment:
| Q |
50 |
taggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
22964062 |
taggttagaattagggttaccaatagcttgaccagacaagctttagtaagtaagat |
22964007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 31554507 - 31554450
Alignment:
| Q |
8 |
aacctgtgaattaaatgcgttagaatgggagggaattattgctaggttagatttagggtt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31554507 |
aacctgtgaattaaatgcgttagaatgggatggaa--attgctaggttagatttagggtt |
31554450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 106
Target Start/End: Complemental strand, 31538634 - 31538599
Alignment:
| Q |
71 |
gttagcttgaccatacaagctttagtaagtaagata |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31538634 |
gttagcttgaccagacaagctttagtaagtaagata |
31538599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 59 - 105
Target Start/End: Original strand, 47402567 - 47402613
Alignment:
| Q |
59 |
tttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47402567 |
tttagggttagggttagcttgacctgacaagctttagtaagtaagat |
47402613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 59 - 105
Target Start/End: Original strand, 43114263 - 43114309
Alignment:
| Q |
59 |
tttagggttagggttagcttgaccatacaagctttagtaagtaagat |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43114263 |
tttagggttagggttagcttgacctgacaagctttagtaagtaagat |
43114309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 50 - 106
Target Start/End: Original strand, 4883599 - 4883655
Alignment:
| Q |
50 |
taggttagatttagggttagggttagcttgaccatacaagctttagtaagtaagata |
106 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4883599 |
taggttagttttagggttaggaatagcttgacctaacaagctttagtaagtaagata |
4883655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University