View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_low_6 (Length: 455)
Name: NF18159_low_6
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 217 - 440
Target Start/End: Complemental strand, 229824 - 229602
Alignment:
| Q |
217 |
cggtaccgatgatgtaagttcacttctctctacttgatcactatttattattagcttttaatattggacttaacacattccttacaaaatcaacgtttac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
229824 |
cggtaccgatgatgtaagttcacttctctctacttgatcactatttattattagcttttaatattggacttaacatat-ccttacaaaatcaacgtttac |
229726 |
T |
 |
| Q |
317 |
catgtcatattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttggta |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229725 |
catgtcatattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttggta |
229626 |
T |
 |
| Q |
417 |
ttttcaatactaataaggttgatc |
440 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
229625 |
ttttcaatactaataaggttgatc |
229602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 116 - 184
Target Start/End: Complemental strand, 229925 - 229857
Alignment:
| Q |
116 |
gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccgga |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229925 |
gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccgga |
229857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University